Rhesus TLR2 (CD282) Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001130425.1

RefSeq ORF Size

2355bp

Gene Synonym

TLR2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus toll-like receptor 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

References

Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.

Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.

Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.

Catalog Number:HGH761-NY