Mouse Tetranectin/CLEC3B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011606.2

RefSeq ORF Size

609bp

Gene Synonym

Tna, Clec3b

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse C-type lectin domain family 3, member b Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

References

Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.

Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.

Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.

Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.

Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.

Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.

Catalog Number:HGH661-CM