Human SULT2B1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGH522-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098bp
Gene Synonym
HSST2, SULT2B1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sulfotransferase family, cytosolic, 2B, member 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sulfotransferase family cytosolic 2B member 1, also known as Sulfotransferase 2B1, ST2B1, Alcohol sulfotransferase, Hydroxysteroid sulfotransferase 2, SULT2B1 and HSST2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. The human hydroxysteroid sulfotransferase (SULT) family is comprised of two subfamilies, SULT2A1 and SULT2B1. SULT2B1 is expressed highly in placenta, prostate and trachea. A lesser expression of SULT1B1 was observed in the small intestine and lung. SULT2B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT2B1 sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol. The two SULT2B1 isoforms, SULT2B1a and SULT2B1b, are encoded by a single gene as a result of alternative transcription initiation and alternative splicing. SULT2B1b catalyzes the sulfonation of 3beta-hydroxysteroid hormones and cholesterol, whereas SULT2B1a preferentially catalyzes pregnenolone sulfonation.
References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Geese,WJ. et al., 2001,Biochem Biophys Res Commun.288 (1): 280-9.
  • Shimizu,C. et al., 2003, Endocrinology. 144 (4):1186-93.
  • Ji,Y. et al., 2007, J Pharmacol Exp Ther. 322 (2): 529-40.
  • TOP