Human SULT1E1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGH519-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
885bp
Gene Synonym
EST, STE, EST-1, MGC34459, SULT1E1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sulfotransferase family 1E, estrogen-preferring, member 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Estrogen sulfotransferase, also known as Sulfotransferase, estrogen-preferring, Sulfotransferase 1E1, SULT1E1 and ST1E1, is a cytoplasm enzyme which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1E1 may control the level of the estrogen receptor by sulfurylating free estradiol. SULT1E1 maximally sulfates beta-estradiol and estrone at concentrations of 20 nM. SULT1E1 also sulfates dehydroepiandrosterone, pregnenolone, ethinylestradiol, equalenin, diethylstilbesterol and 1-naphthol, at significantly higher concentrations; however, cortisol, testosterone and dopamine are not sulfated. SULT1E1 is a key enzyme in estrogen homeostasis. It plays a central role in the prevention and development of human disease.
References
  • Bernier F, et al.,1994, J Biol Chem. 269 (45): 28200-5.
  • Strausberg RL, et al.,2003, Proc. Natl. Acad. Sci. 99 (26): 16899-903.
  • Cole,GB. et al., 2010, Proc Natl Acad Sci USA. 107 (14): 6222-7.
  • TOP