Human SULT1B1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_014465.3

RefSeq ORF Size

891bp

Gene Synonym

ST1B2, SULT1B2, MGC13356, SULT1B1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human sulfotransferase family, cytosolic, 1B, member 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Sulfotransferase family cytosolic 1B member 1, also known as Sulfotransferase 1B1, Sulfotransferase 1B2, Thyroid hormone sulfotransferase, SULT1B1 and ST1B2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1B1 is highly expressed in the liver, peripheral blood leukocytes, colon (mucosal lining), small intestine (jejunum) and spleen. A lesser expression of SULT1B1 was observed in the lung, placenta and thymus. SULT1B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT1B1 sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine.

References

Fujita K. et al., 1997, J. Biochem. 122:1052-61.

Kester,MH.et al., 2003,Am J Physiol Endocrinol Metab. 285 (3):E592-8.

Meinl W, et al., 2001, Biochem Biophys Res Commun. 288 (4): 855-62.

Dombrovski L. et al., 2006, Proteins 64: 1091-4.

Catalog Number:HGH517-NM