Human STK16/PKL12 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH467-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918bp
Gene Synonym
KRCT, MPSK, TSF1, PKL12, STK16
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serine/threonine kinase 16 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine/threonine-protein kinase 16, also known as myristoylated and palmitoylated serine/threonine-protein kinase, Protein kinase PKL12, TGF-beta-stimulated factor 1, TSF-1, MPSK1 and STK16, is a membrane protein which is ubiquitously expressed at very low levels. STK16 / MPSK1 belongs to the protein kinase superfamily and Ser/Thr protein kinase family. It contains one protein kinase domain. Transforming growth factor-beta (TGF-beta) shows a variety of biological activities in various organs or cells. Some factors such as Smads (Sma and Mad proteins) and TGF-beta activating kinase 1 have been characterized as signalling molecules downstream of TGF-beta. Several TGF-beta response elements have been identified such as cAMP response element, Smad binding element, and recognition sites for activating protein-1 and stimulating protein-1 in various gene promoters. STK16 / MPSK1 is an unique factor with two biological functions, transcriptional regulation and protein phosphorylation, that may be involved in TGF-beta signals. STK16 / MPSK1 is a protein kinase that act on both serine and threonine residues. STK16 / MPSK1 possessed DNA-binding ability and activated the TGF-beta responsive CNP promoter or vascular endothelial growth factor gene promoter which possesses a sequence element analogous to the TGF-beta responsive GC-rich element of the CNP promoter. STK16 / MPSK1 did not directly activate a Smads-dependent promoter from plasminogen activator inhibitor 1 gene, but it showed enhancement in co-operation with Smad3 and Smad4. STK16 / MPSK1 mRNA as well as its protein level were stimulated by TGF-beta treatment.
References
  • Ligos J.M., et al., 1998, Biochem. Biophys. Res.Commun. 249:380-4.
  • Berson A.E., et al.,1999, Biochem. Biophys. Res. Commun. 259:533-8.
  • Ohta S., et al., 2000, Biochem. J. 350:395-404.
  • Guinea,B. et al., 2006, Exp Cell Res. 312 (2):135-44. 
  • TOP