Human Statherin / STATH Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGH456-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
189bp
Gene Synonym
STR, STATH
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human statherin Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Statherin, also known as STATH, belongs to the histatin/statherin family. Statherin may play an important role in the maintenance of oral health.It prevents calcium phospate precipitation in saliva, so maintaining a high calcium level in saliva and preventing teeth from dissolving. Statherin also inhibits spontaneous precipitation of calcium phosphate salts. Thus, statherin and PRPs may prevent build-up of harmful deposits in the salivary glands and on the tooth surfaces.Statherin is a highly stable salivary protein of low molecular mass (5,380). Sabatini et al. synthesized mixed oligonucleotides based on the known amino acid sequence of statherin and used these to screen a cDNA library constructed from human parotid gland mRNA.
References
  • Sabatini LM. et al., 1998, Am J Hum Genet. 41 (6): 1048-60.
  • Schlesinger DH. et al., 1997, J Biol Chem. 252 (5): 1689-95.
  • Raj PA. et al., 1992, J Biol Chem. 267 (9): 5968-76.
  • Douglas WH. et al., 1991, Biochem Biophys Res Commun. 180 (1): 91-7.
  • TOP