Mouse STAT1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009283.4

RefSeq ORF Size

2250bp

Gene Synonym

AA408197; 2010005J02Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse signal transducer and activator of transcription 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

STAT1 is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. STAT1 can be activated by various ligands, including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. It is a signal transducer and transcription activator that mediates cellular responses to interferons (IFNs), cytokine KITLG/SCF and other cytokines and growth factors. The phosphorylated STATs dimerize, associate with ISGF3G/IRF-9 to form a complex termed ISGF3 transcription factor, that enters the nucleus. ISGF3 binds to the IFN stimulated response element (ISRE) to activate the transcription of interferon stimulated genes, which drive the cell in an antiviral state. In response to type II IFN (IFN-gamma), STAT1 is tyrosine- and serine-phosphorylated. It then forms a homodimer termed IFN-gamma-activated factor (GAF), migrates into the nucleus and binds to the IFN gamma activated sequence (GAS) to drive the expression of the target genes, inducing a cellular antiviral state. STAT1 becomes activated in response to KITLG/SCF and KIT signaling and may mediate cellular responses to activated FGFR1, FGFR2, FGFR3 and FGFR4. Defects in STAT1 can cause STAT1 deficiency complete and familial candidiasis type 7.

References

Shah S, et al. (2011) A novel disrupter of telomere silencing 1-like (DOT1L) interaction is required for signal transducer and activator of transcription 1 (STAT1)-activated gene expression. J Biol Chem. 286(48):41195-204.

Barthson J, et al. (2011) Cytokines tumor necrosis factor- and interferon-gamma induce pancreatic beta-cell apoptosis through STAT1-mediated Bim protein activation. J Biol Chem. 286(45):39632-43.

Xin Z, et al. (2011) PCBP2 enhances the antiviral activity of IFN- against HCV by stabilizing the mRNA of STAT1 and STAT2. PLoS One. 6(10):e25419.

Perwitasari O, et al. (2011) Inhibitor of B kinase epsilon (IKK(epsilon)), STAT1, and IFIT2 proteins define novel innate immune effector pathway against West Nile virus infection. J Biol Chem. 286(52):44412-23.

Catalog Number:HGH451-CO