Human SOD2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGH315-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669bp
Gene Synonym
SOD2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human superoxide dismutase 2, mitochondrial Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(
References
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • TOP