Human SOCS3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGH310-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
677bp
Gene Synonym
CIS3, SSI3, ATOD4, Cish3, SSI-3, SOCS-3, MGC71791, SOCS3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human suppressor of cytokine signaling 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + XbaI (6kb + 0.72kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Suppressor of cytokine signaling 3, also known as SOCS-3, Cytokine-inducible SH2 protein 3, CIS-3, STAT-induced STAT inhibitor 3, SOCS3 and CIS3, is a protein which is widely expressed with high expression in heart, placenta, skeletal muscle, peripheral blood leukocytes, fetal and adult lung, and fetal liver and kidney. SOCS3 / CIS3 contains one SH2 domain and one SOCS box domain. SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 / CIS3 is involved in negative regulation of cytokines that signal through the JAK / STAT pathway. SOCS3 / CIS3 inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. SOCS3 / CIS3 suppresses fetal liver erythropoiesis. It regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. SOCS3 / CIS3 regulates IL-6 signaling. SOCS3 / CIS3 interacts with multiple activated proteins of the tyrosine kinase signaling pathway including IGF1 receptor, insulin receptor and JAK2. SOCS3 / CIS3 could be used as a possible therapeutic agent for treating rheumatoid arthritis.
References
  • Hoertner M., et al., 2002, Eur. J. Biochem. 269:2516-26.
  • Yamamoto K., et al., 2003, Biochem. Biophys. Res. Commun. 310 : 1188-93.
  • Kamura T., et al., 2004, Genes Dev. 18:3055-65.
  • Okamura A., et al., 2004, Blood 103:2997-3004.
  • Ekelund E., et al., 2006, Am. J. Hum. Genet. 78:1060-5.
  • TOP