Human SMYD3 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGH256-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1287bp
Gene Synonym
KMT3E, ZMYND1, ZNFN3A1, FLJ21080, MGC104324, bA74P14.1, SMYD3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SET and MYND domain containing 3 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.
References
  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • TOP