Human SLITRK6 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH203-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2526bp
Gene Synonym
MGC119595, MGC119596, MGC119597, SLITRK6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SLIT and NTRK-like family, member 6 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SLITRK6 belongs to the SLITRK family. Members of this family share two conserved leucine-rich repeat domains in the extracellular domain. SLITRK6 contains 11 LRR (leucine-rich) repeats, 2 LRRCT domains and 2 LRRNT domains. Expression of SlITRK proteins is highly restricted to neural and brain tumor tissues, but varies within the protein family. SLITRK6 is highly expressed in putamen with no expression in cerebral cortex. It also can be detected in adult and fetal lung and fetal liver. It can suppresse neurite outgrowth. In adult brain, SLITRK6 has a critical role in the development of the inner ear neural circuit.
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10 (11):1788-95.
  • TOP