Human SLAMF7 ORF mammalian expression plasmid, N-His tag Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGH082-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Gene Synonym
19A,CD319,CRACC,CS1,SLAM7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SLAM family member 7 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + XbaI(6kb+1.04kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.
References
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • TOP