Rhesus SIRPG/SIRP gamma/CD172g Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH063-NY

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1164bp
Gene Synonym
SIRPG
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus signal-regulatory protein gamma Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Signal-regulatory protein gamma (SIRPG/SIRP gamma) also known as CD172 antigen-like family member B, CD172g, and CD172g antigen, is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. SIRPG/SIRP gamma/CD172g is probable immunoglobulin-like cell surface receptor. On binding with CD47, SIRPG can mediate cell-cell adhesion. SIRPG/SIRP gamma is engagement on T-cells by CD47 on antigen-presenting cells results in enhanced antigen-specific T-cell proliferation and costimulates T-cell activation. SIRPG/SIRP gamma/CD172g is detected in liver, and at very low levels in brain, heart, lung, pancreas, kidney, placenta and skeletal muscle. Expressed on CD4+ T-cells, CD8+ T-cells, CD56-bright natural killer (NK) cells, CD20+ cells, and all activated NK cells. This cytokine is mainly present in the paracortical T-cell area of lymph nodes, with only sparse positive cells in the mantle and in the germinal center of B-cell follicles. In the thymus, SIRPG is primarily expressed in the medulla on mature T-lymphocytes that have undergone thymic selection.
References
  • Meador JA, et al. (2011) p53-independent downregulation of histone gene expression in human cell lines by high- and low-let radiation. Radiat Res. 175(6): 689-99.
  • Reddy MV, et al. (2011) Association between type 1 diabetes and GWAS SNPs in the southeast US Caucasian population. Genes Immun. 12(3): 208-12.
  • Kawasaki M, et al. (2009) Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus. Clin Exp Rheumatol. 27(2): 260-6.
  • TOP