Human SIGLEC6 / CD327 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGH051-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1281bp
Gene Synonym
CD327, CD33L, OBBP1, CD33L1, CD33L2, CDW327, SIGLEC6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sialic acid binding Ig-like lectin 6 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SIGLEC6, also known as CD327, belongs to the immunoglobulin superfamily, SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC6 is a sialic acid recognizing protein expressed at high levels in placenta (cyto- and syncytiotrophoblastic cells) and at lower levels in spleen, peripheral blood leukocytes (predominantly B-cells) and small intestine. SIGLEC6 localizes in various compartments such as membrane fraction, extracellular region and so on. SIGLEC6 may show increasing expression human labor and following childbirth, it has been speculated that this expression helps to slow the tempo of human labor.  Interestingly, expression of SIGLEC6 is further upregulated in pre-eclampsia, which appears to be a uniquely human disease.
References
  • Winn VD. et al., 2009, Endocrinology. 150 (1): 452-62.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Lam KK. et al., 2011, J Biol Chem. 286 (43): 37118-27.
  • TOP