Rat Serum amyloid P component Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_017170.2

RefSeq ORF Size

687bp

Gene Synonym

Sap, Apcs

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat amyloid P component, serum Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

References

Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.

Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.

Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.

de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.

Catalog Number:HGG969-NY