Human SERPINB3 / SCCA-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGG955-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1218 bp
Gene Synonym
SCC, T4-A, SCCA1, SCCA-1, HsT1196, SCCA-PD, SERPINB3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
KpnI + XbaI(6kb+1.22kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SERPINB3, also known as SCCA-1, belongs to the serpin family. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases. SERPINB3 is expressed in some hepatocellular carcinoma (at protein level). Its expression is closely related to cellular differentiation in both normal and malignant squamous cells. It seems to also be secreted in plasma by cancerous cells but at a low level. SERPINB3 significantly attenuates apoptosis by contrasting cytochrome c release from the mitochondria and by antichemotactic effect for NK cells. It may act as a protease inhibitor to modulate the host immune response against tumor cells and may be involved in the malignant behavior of squamous cell carcinoma cells.
References
  • Schneider SS, et al. (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci. 92(8):3147-51.
  • Suminami Y, et al.. (1992) Squamous cell carcinoma antigen is a new member of the serine protease inhibitors. Biochem Biophys Res Commun. 181(1):51-8.
  • Mino-Miyagawa N, et al. (1990) Tumor-antigen 4. Its immunohistochemical distribution and tissue and serum concentrations in squamous cell carcinoma of the lung and esophagus. Cancer. 66(7):1505-12.
  • TOP