Cynomolgus SerpinA3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Cynomolgus

NCBI Ref Seq

XM_005562128.1

RefSeq ORF Size

1272bp

Gene Synonym

SERPINA3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Cynomolgus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

References

Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.

Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.

Vila, N. et al., 2000, Stroke. 31: 2103-2105

Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.

Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.

Catalog Number:HGG942-NM