Human SerpinA10 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Gene

Species

Human

NCBI Ref Seq

NM_001100607.1

RefSeq ORF Size

1335bp

Gene Synonym

PZI, ZPI

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-GFPSpark

Restriction Site

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA10 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA10 / Serpin-A10 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1000 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.

References

Han X, et al., 1998, Proc Natl Acad Sci. USA 95: 9250-5.

Han X, et al., 2000, Blood 96: 3049-55.

Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.

Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.

Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.

Water N, et al., 2004, Br J Haematol. 127:190-4.

Wei Z, et al., 2009, Blood 114 (17): 3662-7.

Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.

Catalog Number:HGG939-CG