Human Semaphorin 5A/SEMA5A Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGG919-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3225bp
Gene Synonym
semF, SEMAF, FLJ12815
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration. Semaphorin-5A, also known as Semaphorin-F, Sema F, SEMA5A and SEMAF, is a single-pass type I membrane protein which belongs to the semaphorin family. Semaphorin5A / SEMA5A contains one PSI domain, one Sema domain and seven TSP type-1 domains. It may act as positive axonal guidance cues. Semaphorin5A / SEMA5A is an axon regulator molecule and plays major roles during neuronal and vascular development. It plays an essential role in embryonic development. Semaphorin5A / SEMA5A induces endothelial cell migration from pre-existing vessels. It also plays a role in autism, reducing the ability of neurons to form connections with other neurons in certain brain regions.
References
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci.  99 (26): 16899-903.
  • Neufeld G. et al., 2005, Front Biosci. 10: 751-60.
  • Fiore R. et al., 2005, Mol Cell Biol. 25 (6): 2310-9.
  • Yazdani U. et al., 2006, Genome Biol. 7 (3): 211.
  • Sadanandam A. et al., 2010, Microvasc Res. 79 (1): 1-9.
  • TOP