Human SECTM1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC017716

RefSeq ORF Size

747bp

Gene Synonym

K12, SECTM1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human secreted and transmembrane 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Secreted and transmembrane 1 (SECTM1), also known as K12, is a transmembrane and secreted protein with characteristics of a type 1a transmembrane protein of SECTM family. It is found in a perinuclear Golgi-like pattern and thought to be involved in hematopoietic and/or immune system processes. The human K12 protein has been shown to be primarily expressed in spleen, prostate, testis, small intestine, and in peripheral blood leukocytes. The K12 protein is expressed on the cell surface in such small amounts as to preclude detection. Alternatively, it may be that K12 on the cell surface is rapidly cleaved to generate a soluble K12 protein. Immunohistochemical analysis of peripheral blood cells shows that K12 is found in leukocytes of the myeloid lineage, with the strongest staining observed in granulocytes and no detectable expression in lymphocytes. May be involved in thymocyte signaling. It had been suggested a role for thymic microenvironment-produced K12 in regulation of thymocyte signaling and cytokine release, particularly in the setting of thymus pathology where IFN-gamma is upregulated such as myasthenia gravis. In addition, as a putative natural CD7 ligand, SECTM1/K12 may be responsible for the costimulatory role it plays in T cell activation.

References

Leta E, et al. (1995) Production and characterization of the extracellular domain of human CD7 antigen: further evidence that CD7 has a role in T cell signaling. Cell Immunol. 165(1): 101-9.

Slentz-Kesler KA, et al. (1998) Identification and characterization of K12 (SECTM1), a novel human gene that encodes a Golgi-associated protein with transmembrane and secreted isoforms. Genomics. 47(3): 327-40.

Lyman SD, et al. (2000) Identification of CD7 as a cognate of the human K12 (SECTM1) protein. J Biol Chem. 275(5): 3431-7.

Lam GK, et al. (2005) Expression of the CD7 ligand K-12 in human thymic epithelial cells: regulation by IFN-gamma. J Clin Immunol. 25(1): 41-9.

Catalog Number:HGG902-CF