Mouse SDF-2/SDF2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG876-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
AI853825, MGC107120, Sdf2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse stromal cell derived factor 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Stromal derived factors (SDFs) are a loosely defined group of molecules that are generated by stromal cells. Two of the stromal derived factors, SDF-1 and SDF-4 belong to the chemokine family. Other SDFs, such as SDF-2 and SDF-5 are not well defined and their biological functions are less known. SDF-2 is first isolated from the mouse stromal cell line ST2 as a secretory protein. The amino acid sequence deduced from the murine clone and the human homolog are conserved more than 92 %, and the aa sequence of SDF-2 shows similarity to those of yeast dolichyl phosphate-D-mannose, protein mannosyltransferases. SDF-1 and its receptor are strongly indicated in the progression of various cancers including breast cancer. SDF-2, SDF2-L1, SDF-4, and SDF-5 are ubiquitously expressed in various cancer cell lines and SDF-2, SDF-4 and SDF-5 are expressed in mammary tissues. These SDFs have prognostic value and warrant further investigation in their biological functions and clinical value.
References
  • Hamada,T.etal.,1996,Gene.176(1-2):211-214.
  • Anjard,C.etal.,1998,Development.125(20):4067-4075.
  • Kang,H.etal.,2009,Int J Oncol.35(1):205-211. 
  • TOP