Human SCN3B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC117282

RefSeq ORF Size

648bp

Gene Synonym

HSA243396, SCNB3, SCN3B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human sodium channel, voltage-gated, type III, beta Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SCN3B (sodium channel, voltage-gated, type III, beta ,human IgG1-Fc chimera) belongs to the sodium channel auxiliary subunit SCN3B family. It contains 1 Ig-like C2-type (immunoglobulin-like) domain. Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. SCN3B gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. Defects in SCN3B are the cause of Brugada syndrome type 7. A tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram. It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs (called ventricular fibrillation), the individual will faint and may die in a few minutes if the heart is not reset.

References

Morgan K, et al. (2000) _3: An additional auxiliary subunit of the voltage-sensitive sodium channel that modulates channel gating with distinct kinetics. Proc Natl Acad Sci. 97(5):2308-13.

Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10(11): 1788-95.

Hirosawa M, et al. (2000) Characterization of cDNA clones selected by the GeneMark analysis from size-fractionated cDNA libraries from human brain. DNA Res. 6(5):329-36.

Catalog Number:HGG862-NY