Human SCG2 / Secretogranin II Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG847-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1854bp
Gene Synonym
SN, CHGC, SgII, SCG2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human secretogranin II (chromogranin C) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kit ligand, also known as Hematopoietic growth factor KL, Mast cell growth factor, Steel factor, Stem cell factor, c-Kit ligand, Kitlg and KITL, is a single-pass type I membrane protein which belongs to the SCF family. KITL / kit ligand also belongs to the family of dimeric transmembrane growth factors. The soluble form of KIT ligand is a secreted protein. Mast cells are thought to participate in a variety of immune responses, such as parasite resistance and the allergic reaction. Mast cell development depends on stem cell factor (Kit ligand) and its receptor, c-Kit. KITL / kit ligand stimulates the proliferation of mast cells. KITL / kit ligand is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. Efficient cell surface presentation of KITL / kit ligand is essential for the migration, proliferation, and survival of melanocytes, germ cells, hemopoietic stem cells, and mastocytes. KITL / kit ligand acts synergistically with other cytokines, probably interleukins. KITL / kit ligand plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin. It exerts permanent survival, proliferation and migration functions in Kit receptor-expressing melanocytes. KITL / kit ligand misexpression in some hyperpigmented lesions may open the avenue for Kitl-dependent treatment of pathological skin conditions.
References
  • Nishida,K.et al., 2002, Blood. 99 (5):1866-9.
  • Paulhe,F. et al., 2004,J Biol Chem. 279 (53):55545-55.
  • Fernandez,S.M. et al., 2008,Biol Reprod. 79 (2):318-27.
  • Wehrle-Haller,B. et al., 2003,Pigment Cell Res.16 (3):287-96.
  • TOP