Rat S100A16 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGG794-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
372bp
Gene Synonym
S100a16
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat S100 calcium binding protein A16 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.
References
  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • TOP