Mouse RSPO3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGG756-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834bp
Gene Synonym
Thsd2, AW742308, Cristin1, MGC118442, 2810459H04Rik, Rspo3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse R-spondin 3 homolog (Xenopus laevis) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.
References
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • TOP