Human RNase A / Ribonuclease A / RNASE1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC005324

RefSeq ORF Size

471bp

Gene Synonym

RIB1, RNS1, RNASE1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ribonuclease, RNase A family, 1 (pancreatic) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RNase A, also known as ribonuclease A and RNASE1, belongs to ribonuclease A superfamily. It is a pancreatic-type of secretory ribonuclease. RNase A is a basic protein and its many positive charges are consistent with its binding to RNA (a poly-anion). More generally, RNase A is unusually polar or, rather, unusually lacking in hydrophobic groups, especially aliphatic ones. As a endonuclease, RNase A cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. RNase A is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified.

References

Tubert P, et al. (2011) Interactions crucial for three-dimensional domain swapping in the HP-RNase variant PM8. Biophys J. 101(2):459-67.

Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.

Fischer S, et al. (2011) Expression and localisation of vascular ribonucleases in endothelial cells. Thromb Haemost. 105(2):345-55.

Catalog Number:HGG598-CF