Human RIOK1 / RIO kinase 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGG583-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1707bp
Gene Synonym
AD034, RRP10, bA288G3.1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RIO kinase 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RIOK1, also known as RIO kinase 1, is a member of the RIO family of atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its symmetrical methylation.
References
  • Widmann B. et al., 2012, Mol Biol Cell. 23 (1): 22-35.
  • LaRonde-LeBlanc N. et al., 2005, Biochim Biophys Acta. 1754 (1-2): 14-24.
  • Guderian G. et al., 2011, J Biol Chem. 286 (3): 1976-86.
  • TOP