Human RET transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG505-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3345bp
Gene Synonym
PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, CDHR16, RET-ELE1, RET
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ret proto-oncogene, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RET proto-oncogene, also known as RET, is a cell-surface molecule that transduce signals for cell growth and differentiation. It contains 1 cadherin domain and 1 protein kinase domain. RET proto-oncogene belongs to the protein kinase superfamily, tyr protein kinase family. RET proto-oncogene is involved in numerous cellular mechanisms including cell proliferation, neuronal navigation, cell migration, and cell differentiation upon binding with glial cell derived neurotrophic factor family ligands. It phosphorylates PTK2/FAK1 and regulates both cell death/survival balance and positional information. RET is required for the molecular mechanisms orchestration during intestine organogenesis; involved in the development of enteric nervous system and renal organogenesis during embryonic life; promotes the formation of Peyer's patch-like structures; modulates cell adhesion via its cleavage; involved in the development of the neural crest. RET proto-oncogene is active in the absence of ligand, triggering apoptosis. RET acts as a dependence receptor; in the presence of the ligand GDNF in somatotrophs (within pituitary), promotes survival and down regulates growth hormone (GH) production, but triggers apoptosis in absence of GDNF. It also regulates nociceptor survival and size; triggers the differentiation of rapidly adapting (RA) mechanoreceptors; mediated several diseases such as neuroendocrine cancers. Defects in RET may cause colorectal cancer, hirschsprung disease type 1, medullary thyroid carcinoma, multiple neoplasia type 2B, susceptibility to pheochromocytoma, multiple neoplasia type 2A, thyroid papillary carcinoma and congenital central hypoventilation syndrome.
References
  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Ciampi R, et al. (2012) Chromosome 10 and RET gene copy number alterations in hereditary and sporadic Medullary Thyroid Carcinoma. Mol Cell Endocrinol. 348(1):176-82.
  • Garcia-Lavandeira M, et al. (2012) Craniopharyngiomas express embryonic stem cell markers (SOX2, OCT4, KLF4, and SOX9) as pituitary stem cells but do not coexpress RET/GFRA3 receptors. J Clin Endocrinol Metab. 97(1):E80-7.
  • Stine ZE, et al. (2011) Steroid hormone modulation of RET through two estrogen responsive enhancers in breast cancer. Hum Mol Genet. 20(19):3746-56.
  • Sharma BP, et al. (2011) RET gene mutations and polymorphisms in medullary thyroid carcinomas in Indian patients. J Biosci. 36(4):603-11.
  • TOP