Human REG3G Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:HGG485-CH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
528bp
Gene Synonym
PAP1B, PAPIB, UNQ429, REG-III, MGC118998, MGC118999, MGC119001, REG3G
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lumican Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids. Regenerating islet-derived 3 gamma (REG3G), also known as pancreatitis-associated protein 1B (PAP1B), is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. REG3G is expressed weakly in pancreas, strongly in intestinal tract, but not in hyperplastic islets REG3G might be a stress protein involved in the control of bacterial proliferation. It was indicated that REG3G specifically targets Gram-positive bacteria because it binds to their surface peptidoglycan layer, and serves as one of several antimicrobial peptides produced by paneth cells via stimulation of toll-like receptors (TLRs) by pathogen-associated molecular patterns (PAMPs).
References
  • Narushima Y, et al. (1997) Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene. 185(2): 159-68.
  • Nata K, et al. (2004) Molecular cloning, expression and chromosomal localization of a novel human REG family gene, REG III. Gene. 340(1): 161-70.
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727(3): 177-87.
  • Castellarin ML, et al. (2007) The identification and sequence analysis of a new Reg3gamma and Reg2 in the Syrian golden hamster. Biochim Biophys Acta. 1769(9-10): 579-85.
  • TOP