Human RAGE/AGER transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG389-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1215bp
Gene Synonym
RAGE, MGC22357, AGER
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human advanced glycosylation end product-specific receptor, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + XbaI (6kb + 1.24kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.
References
  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • TOP