Rat RACK1/GNB2L1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_130734.2

RefSeq ORF Size

954bp

Gene Synonym

RACK1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RACK1 (guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1), also known as GNB2L1, contains 7 WD repeats and belongs to the WD repeat G protein beta family. In the liver, RACK1 is expressed at higher levels in activated hepatic stellate cells than in hepatocytes or Kupffer cells. It is up-regulated in hepatocellular carcinomas and in the adjacent non-tumor liver tissue. RACK1 is involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. It interacts with a wide variety of proteins and plays a role in many cellular processes. GNB2L1 binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. RACK1 may recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. It inhibits the activity of SRC kinases including SRC, LCK and YES1. RACK1 also inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. It enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer.

References

Jannot G, et al.. (2011) The ribosomal protein RACK1 is required for microRNA function in both C. elegans and humans. EMBO Rep. 12(6):581-6.

Wang F, et al. (2011) RACK1 regulates VEGF/Flt1-mediated cell migration via activation of a PI3K/Akt pathway. J Biol Chem. 286(11):9097-106.

Cao XX, et al. (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat. 126(3):555-63.

Myklebust LM, et al. (2011) Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 21(11):1217-25.

Catalog Number:HGG375-NO