Human PTX3/Pentraxin 3/TSG-14 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_002852

RefSeq ORF Size

1146bp

Gene Synonym

TSG-14, TNFAIP5, PTX3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human pentraxin-related gene, rapidly induced by IL-1 betaV Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Pentraxin-related protein PTX3, also known as Tumor necrosis factor alpha-induced protein 5, Tumor necrosis factor-inducible gene 14 protein, TSG-14, PTX3 and TNFAIP5, is a secreted protein which contains one pentaxin domain. PTX3 plays a role in the regulation of innate resistance to pathogens, inflammatory reactions, possibly clearance of self-components and female fertility. Pentraxins are a family of evolutionarily conserved multifunctional pattern-recognition proteins characterized by a cyclic multimeric structure. Based on the primary structure of the subunit, the pentraxins are divided into two groups: short pentraxins and long pentraxins. C-reactive protein (CRP) and serum amyloid P-component (SAP) are the two short pentraxins. The prototype protein of the long pentraxin group is pentraxin 3 (PTX3). CRP and SAP are produced primarily in the liver in response to IL-6, while PTX3 is produced by a variety of tissues and cells and in particular by innate immunity cells in response to proinflammatory signals and Toll-like receptor (TLR) engagement. PTX3 is essential in female fertility by acting as a nodal point for the assembly of the cumulus oophorus hyaluronan-rich extracellular matrix. PTX3 interacts with several ligands, including growth factors, extracellular matrix components and selected pathogens, playing a role in complement activation and facilitating pathogen recognition by phagocytes, acting as a predecessor of antibodies. PTX3 may also contribute to the pathogenesis of atherosclerosis.

References

Rolph,M.S. et al., 2002, Arterioscler Thromb Vasc Biol. 22 (5):e10-4.

Mantovani A., et al., 2003, Vaccine. 21:S43-S47.

Luchetti,M.M. et al., 2004, Clin Exp Rheumatol. 22 (3):S66-72.

Mantovani, A. et al., 2006, Vascul Pharmacol. 45 (5):326-30.

Inforzato A., et al., 2008, J. Biol. Chem. 283:10147-61.

Catalog Number:HGG285-NO