Human PTH1R/PTHR1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG261-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1002bp
Gene Synonym
PFE, PTHR, PTHR1, PTH1R
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human parathyroid hormone 1 receptor Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Parathyroid hormone / parathyroid hormone-related peptide receptor, also known as PTH / PTHrP type I receptor, PTH/PTHr receptor, Parathyroid hormone 1 receptor, PTH1 receptor, PTH1R and PTHR, is a multi-pass membrane protein which belongs to the G-protein coupled receptor 2 family. PTH1R is expressed in most tissues. It is most abundant in kidney, bone and liver. PTH1R is expressed in high levels in bone and kidney and regulates calcium ion homeostasis through activation of adenylate cyclase and phospholipase C. In bone, PTH1R is expressed on the surface of osteoblasts. When the receptor is activated, these cells in turn stimulate osteoclasts to ultimately increase the resorption rate. PTH1R is a receptor for parathyroid hormone and for parathyroid hormone-related peptide. The activity of PTH1R is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in PTH1R are the cause of Jansen metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), enchondromatosis multiple (ENCHOM), Eiken skeletal dysplasia (EISD) and primary failure of tooth eruption (PFE).
References
  • Schipani E., et al., 1993, Endocrinology 132:2157-2165.
  • Hopyan S., et al., 2002, Nat. Genet. 30:306-310.
  • Bastepe M., et al., 2004, J. Clin. Endocrinol. Metab. 89:3595-3600.
  • Duchatelet S., et al., 2005, Hum. Mol. Genet. 14:1-5.
  • Decker E., et al., 2008, Am. J. Hum. Genet. 83:781-786.
  • TOP