Rat PTGDS / L-PGDS Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGG255-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
570bp
Gene Synonym
PH2DISO
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat prostaglandin D2 synthase (brain) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.
References
  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • TOP