Mouse PSGL-1/CD162 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

X91144.1

RefSeq ORF Size

1194bp

Gene Synonym

CD162, Psgl1, Selp1, Selpl, Psgl-1, Selplg

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse selectin, platelet (p-selectin) ligand Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

References

1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

Catalog Number:HGG201-CM