Mouse Prostatic Acid Phosphatase/ACPP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGG154-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1248bp
Gene Synonym
Lap, PAP, Ppal, AI324033, A030005E02Rik, Acpp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse acid phosphatase, prostate Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Prostatic acid phosphatase (PAP, or ACPP), also known as prostatic specific acid phosphatase (PSAP), is an enzyme produced by the prostate. As a non-specific phosphomonoesterase, Prostatic acid phosphatase synthetized and secreted into seminal plasma under androgenic control. The enzyme is a dimer of molecular weight around 100 kDa. Prostatic acid phosphatase is a clinically important protein for its relevance as a biomarker of prostate carcinoma. Furthermore, it has a potential role in fertilization. The major action of PAP is to dephosphorylate macromolecules with the help of catalytic residues (His(12) and Asp(258)) that are located in the cleft between two domains. Cellular prostatic acid phosphatase (cPAcP), an authentic tyrosine phosphatase, is proposed to function as a negative growth regulator of prostate cancer (PCa) cells in part through its dephosphorylation of ErbB-2. cPAcP functions as a neutral protein tyrosine phosphatase (PTP) in prostate cancer cells and dephosphorylates HER-2/ErbB-2/Neu (HER-2: human epidermal growth factor receptor-2) at the phosphotyrosine (p-Tyr) residues. Injection of the secretory isoform of PAP has potent antinociceptive effects in mouse models of chronic pain. This enzyme exhibits ecto-5'-nucleotidase activity, is widely distributed, and implicated in the formation of chronic pain. Additionally, PAP could be a target molecule in specific immunotherapy for patients with nonprostate adenocarcinomas including colon and gastric cancers.
References
  • Hassan MI, et al. (2010) Structural and functional analysis of human prostatic acid phosphatase. Expert Rev Anticancer Ther. 10(7): 1055-68.
  • Chuang TD, et al. (2010) Human prostatic acid phosphatase, an authentic tyrosine phosphatase, dephosphorylates ErbB-2 and regulates prostate cancer cell growth. J Biol Chem. 285(31): 23598-606.
  • Larsen RS, et al. (2009) A high throughput assay to identify small molecule modulators of prostatic acid phosphatase. Curr Chem Genomics. 3: 42-9.
  • Zimmermann H. (2009) Prostatic acid phosphatase, a neglected ectonucleotidase. Purinergic Signal. 5(3): 273-5.
  • Wang Y, et al. (2005) Prostatic acid phosphatase as a target molecule in specific immunotherapy for patients with nonprostate adenocarcinoma. J Immunother. 28(6): 535-41.
  • Veeramani S, et al. (2005) Cellular prostatic acid phosphatase: a protein tyrosine phosphatase involved in androgen-independent proliferation of prostate cancer. Endocr Relat Cancer. 12(4): 805-22.
  • Ostrowski WS, et al. (1994) Human prostatic acid phosphatase: selected properties and practical applications. Clin Chim Acta. 226(2): 121-9.
  • TOP