Human PRMT3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_005788.3

RefSeq ORF Size

1596bp

Gene Synonym

HRMT1L3, PRMT3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human protein arginine methyltransferase 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein arginine methyltransferase 3, also known as PRMT3, is one of four type I protein arginine methyltransferases (PRMT) that in humans is encoded by the PRMT3 gene. Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. In human cells, the PRMT family consists of eight canonical members. PRMTs have been classified into two groups based on the end product. Certain PRMTs display different subcellular localization in different cell types, implicating cell- and tissue-specific mechanisms for regulating PRMT functions. PRMT3 is unique in that its N-terminus harbours a C2H2 zinc-finger domain that is proposed to confer substrate specificity. In addition, PRMT3 is the only type I enzyme that is restricted to the cytoplasm. A large proportion of this cystosolic PRMT3 is found associated with ribosomes. It is tethered to the ribosomes through its interaction with rpS2, which is also its substrate.

References

Swiercz, R. et al., 2005, Biochem J. 386 (Pt 1): 85-91.

Iwasaki, H., 2008, Biochem Biophys Res Commun 372 (2): 314-9.

Lei, NZ. et al., 2009, Nucleic acids Res 37 (3): 832-48.

Fan, Q. et al., 2009, Biochem J. 421 (1): 107-18.

Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.

Kölbel, K. J Biol Chem 2009, 284 (13): 8274-82.

Catalog Number:HGG130-CF