Human PRDM2 / RIZ1 ORF mammalian expression plasmid, N-His tag Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

RefSeq ORF Size

1514bp

Gene Synonym

RIZ, KMT8, RIZ1, RIZ2, MTB-ZF, HUMHOXY1, PRDM2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human PR domain containing 2, with ZNF domain Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PR domain containing 2, with ZNF domain (PRDM2), also known as zinc finger protein RIZ, is a member of histone methyltransferase (HMT) class enzymes that methylate lysine residues of histones or proteins. HMTs contain a conserved catalytic core termed the SET domain, which shares sequence homology with an independently described sequence motif, the PR domain. PRDM2 contains 8 C2H2-type zinc fingers and a distinct SET domain, and is highly expressed in retinoblastoma cell lines and in brain tumors, as well as in a number of other cell lines and in brain, heart, skeletal muscle, liver and spleen. PRDM2 is a S-adenosyl-L-methionine-dependent histone methyltransferase that specifically methylates 'Lys-9' of histone H3, and is identified as a tumor suppressor. It is reported that intact PR( SET) sequence is required for tumor suppression functions, mutations in the PR domain caused activity reduction in human cancers. Also, S-adenosylhomocysteine or methyl donor deficiency inhibits RIZ1 and other H3 lysine 9 methylation activities. PRDM2 may also function as a DNA-binding transcription factor. It Binds to the macrophage-specific TPA-responsive element (MTE) of the HMOX1 (heme oxygenase 1) gene and act as a transcriptional activator. In addition, PRDM2 (RIZ) is able to binds to the retinoblastoma protein (RB) and also Interacts with GATA3.

References

Buyes, I.M. et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92: 4467-4471.

Muraosa, Y. et al., 1996, Eur. J. Biochem. 235: 471-479.

Kim, K. et al., 2003, Cancer. Res. 63: 7619-7623.

Shapiro, V.S. et al., 1995, Gene. 163: 329-330.

Briknarova, K.et al.,2008,Biochem.Biophys.Res.Commun.366:807-813.

Catalog Number:HGG082-CF