Human PRC1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC003138

RefSeq ORF Size

1863bp

Gene Synonym

ASE1, PRC1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human protein regulator of cytokinesis 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis. It interacts with KIF14, IF20A and PLK1.

References

Jiang W, et al. (1999) PRC1: a human mitotic spindle-associated CDK substrate protein required for cytokinesis. Mol Cell. 2(6):877-85.

Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):173-8.

Mollinari C, et al. (2002) PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol. 15 (7):1175-86.

Catalog Number:HGG080-CF