Rat Podoplanin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF970-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
501bp
Gene Synonym
E11, Gp38, OTS-8, RTI40, T1-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat podoplanin Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.
References
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • TOP