Human Pleckstrin / PLEK / p47 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF910-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053bp
Gene Synonym
P47, PLEK
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pleckstrin Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pleckstrin is a protein found in platelets. Pleckstrin is the source of the name pleckstrin homology domain. Pleckstrin homology domain (PH domain) is a protein domain of approximately 120 amino acids that occurs in a wide range of proteins involved in intracellular signaling or as constituents of the cytoskeleton. This domain can bind Phosphatidylinositol lipids within biological membranes (such as Phosphatidylinositol (3,4,5)-trisphosphate and phosphatidylinositol (4,5)-bisphosphate), and proteins such as the βγ-subunits of heterotrimeric G proteins, and protein kinase C. Through these interactions, PH domains play a role in recruiting proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways.
References
  • Ingley E, et al. (1994) Pleckstrin homology (PH) domains in signal transduction. J Cell Biochem. 56(4):436-43.
  • Gibson TJ, et al. (1994) PH domain: the first anniversary. Trends Biochem Sci. 19(9):349-53.
  • Haslam RJ, et al. (1993) Pleckstrin domain homology. Nature. 363(6427):309-10.
  • TOP