Human PLAUR/CD87 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGF905-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008bp
Gene Synonym
CD87, UPAR, URKR, PLAUR
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human plasminogen activator, urokinase receptor , transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Urokinase plasminogen activator (uPA) and/or its receptor (uPAR) are essential for metastasis, and overexpression of these molecules is strongly correlated with poor prognosis in a variety of malignant tumours. uPAR and uPA levels in both resected tumor tissue and plasma are of independent prognostic significance for patient survival in several types of human cancer. This system has classically been thought to drive tumor progression by mediating directed extracellular proteolysis on the surface of migrating or invading cells, and intervening with this proteolysis by targeting uPAR has been proposed to represent a novel approach for inhibiting tumor progression. uPAR, also known as PLAUR or CD87, has been implicated in the growth, metastasis, and angiogenesis of several solid and hemotologic malignancies. uPAR is a highly glycosylated, 55-60kDa integral membrane protein linked to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchor. It is part of a cell surface system that also consists of the serine protease uPA and several specific inhibitors (plasminogen activator inhibitors 1 and 2). Additionally, the analysis of CD87 (urokinase-type plasminogen activator receptor - uPAR) expression has a potential role in the diagnostic or prognostic work-up of several hematological malignancies, particularly acute leukemia and multiple myeloma.
References
  • Romer J, et al. (2004) The urokinase receptor as a potential target in cancer therapy. Curr Pharm Des. 10(19): 2359-76.
  • Bn MC, et al. (2004) CD87 (urokinase-type plasminogen activator receptor), function and pathology in hematological disorders: a review. Leukemia. 18(3): 394-400.
  • Pillay V, et al. (2007) The urokinase plasminogen activator receptor as a gene therapy target for cancer. Trends Biotechnol. 25(1): 33-9.
  • Mazar AP. (2008) Urokinase plasminogen activator receptor choreographs multiple ligand interactions: implications for tumor progression and therapy. Clin Cancer Res. 14(18): 5649-55.
  • TOP