Human Placental Lactogen / CSH1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF901-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654bp
Gene Synonym
CSH1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chorionic somatomammotropin hormone 1 (placental lactogen) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein which belongs to the somatotropin / prolactin family. CSH1 is produced only during pregnancy and is involved in stimulating lactation, fetal growth and metabolism. Does not interact with GHR but only activates PRLR through zinc-induced dimerization. The CSH1 gene is member of the GH gene cluster on 17q, which consists of two growth hormone genes and three CSH genes. Genomic alterations in the GH cluster are well known, causing different phenotypes depending on the size of the deletion and the genes involved. The increased prevalence of hemizygosity of CSH1 in population in comparison to controls indicates a role for CSH1 haploinsufficiency in the etiology of growth retardation. Investigation of CSH1 deletions in further SRS and growth retarded patients will enable us to establish under which circumstances haploinsufficiency of CSH1 is likely to result in clinical changes.
References
  • Prager,S. et al., 2003,Genet Test. 7 (3):259-63.
  • Singleton, DR. et al., 2004, Microbiology. 150 (Pt 2): 285-92.
  • Chen,Y. et al., 2008, Cancer Res. 68 (23):9729-34.
  • TOP