Human Pin1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_006221.2

RefSeq ORF Size

492bp

Gene Synonym

PIN1, DOD, UBL5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Peptidyl-prolyl cis-trans isomerase Pin1, also known as Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1, Rotamase Pin1 and PIN1, peptidyl-prolyl cis/trans isomerase (PPIase), is a nucleus protein. PIN1 is a peptidyl-prolyl isomerase that can alter the conformation of phosphoproteins and so affect protein function and/or stability. PIN1 regulates a number of proteins important for cell-cycle progression and is presumed to operate as a molecular timer of this important process. PIN1 is an essential PPIase that regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. PIN1 displays a preference for an acidic residue N-terminal to the isomerized proline bond. Alterations in the level of PIN1 can influence hyperproliferative diseases such as cancer. PIN1 has been implicated in multiple aspects of cell cycle regulation. It has been suggested that PIN1 function is required for both normal mitotic progression and reentry into the cell cycle from quiescence. PIN1 is also a target of several oncogenic pathways and is overexpressed in human breast cancer. Its overexpression can lead to upregulation of cyclin-D1 and transformation of breast epithelial cells in collaboration with the oncogenic pathways. PIN1 plays a pivotal role in breast development and may be a promising new anticancer target. Pin1 activity regulates the outcome of proline-directed kinase (e.g. MAPK, CDK or GSK3) signalling and consequently regulates cell proliferation (in part through control of cyclin D1 levels and stability) and cell survival. Recent data also implicate Pin1 as playing an important role in immune responses, at least in part by increasing the stability of cytokine mRNAs by influencing the protein complexes to which they bind.

References

Liou YC, et al. (2003) Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature. 424(6948): 556-61.

Ryo A, et al. (2001) Pin1 regulates turnover and subcellular localization of beta-catenin by inhibiting its interaction with APC. Nat Cell Biol. 3(9): 793-801.

Geldner N, et al. (2001) Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature. 413(6854): 425-8.

Catalog Number:HGF862-NY