Human PI3/Elafin/WFDC14 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF833-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
354bp
Gene Synonym
ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peptidase inhibitor 3, skin-derived Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.
References
TOP