Mouse PGDH/PHGDH Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGF796-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1602bp
Gene Synonym
A10; PGD; PGAD; PGDH; SERA; 3PGDH; 3-PGDH; 4930479N23
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse 3-phosphoglycerate dehydrogenase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PHGDH is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. This new family consists of D-isomer-stereospecific enzymes. The conserved residues in this family appear to be the residues involved in the substrate binding and the catalytic reaction, and thus to be targets for site-directed mutagenesis. A number of NAD-dependent 2-hydroxyacid dehydrogenases which seem to be specific for the D-isomer of their substrate have been shown to be functionally and structurally related. PHGDH catalyzes the transition of 3-phosphoglycerate into 3-phosphohydroxypyruvate, which is the first and rate-limiting step in the phosphorylated pathway of serine biosynthesis, using NAD+/NADH as a cofactor. Overexpression of PHGDH may cause certain breast cancers. Defects in PHGDH are the cause of phosphoglycerate dehydrogenase deficiency which is characterized by congenital microcephaly, psychomotor retardation, and seizures.
References
  • Pind S, et al. (2002) V490M, a common mutation in 3-phosphoglycerate dehydrogenase deficiency, causes enzyme deficiency by decreasing the yield of mature enzyme. J Biol Chem. 277 (9): 7136-43.
  • Du H, et al. (2010) 3-Phosphoglycerate dehydrogenase expression is regulated by HOXA10 in murine endometrium and human endometrial cells. Reproduction. 139 (1): 237-45.
  • Possemato R, et al. (2011) Functional genomics reveal that the serine synthesis pathway is essential in breast cancer. Nature. 476 (7360): 346-50.
  • TOP