Human PFK2 / PFKFB3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGF784-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1563bp
Gene Synonym
PFK2, IPFK2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fructose-2,6-biphosphatase 3, also known as 6-phosphofructo-2-kinase or PFK2 or PFKFB3, is a potent activator of phosphofructokinase, which is a rate-limiting enzyme of glycolysis. Highly phosphorylated PFKFB3 protein was found in human tumor cells, vascular endothelial cells, and smooth muscle cells. Fructose 2,6-bisphosphate (Fru-2,6-BP) is an allosteric activator of 6-phosphofructo-1-kinase (PFK-1), a rate-limiting enzyme and essential control point in glycolysis. The concentration of PFK2 depends on the activity of the bifunctional enzyme, 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK-2 / FBPase). PFK2 controls the glycolytic flux via the allosteric activator fructose 2,6-bisphosphate. Because of its proto-oncogenic character, the PFK-2/FBPase-2 of the PFKFB3 gene is assumed to play a critical role in tumorigenesis. The hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3) plays a crucial role in the progression of cancerous cells by enabling their glycolytic pathways even under severe hypoxic conditions.
References
  • Kessler R, et al. (2008) 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB3) is up-regulated in high-grade astrocytomas. J Neurooncol. 86(3):257-64.
  • Yalcin A, et al. (2009) Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J Biol Chem. 284(36):24223-32.
  • Atsumi T, et al. (2002) High expression of inducible 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 262(20): 5881-7.
  • Kim SG, et al. (2006) Crystal structure of the hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3): a possible new target for cancer therapy. J Biol Chem. 281(5): 2939-44.
  • TOP