Human PFDN4 / PFD4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF780-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
405bp
Gene Synonym
C1, PFD4, PFDN4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prefoldin subunit 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.
References
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • TOP