Human Pepsinogen C/PGC Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF752-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1167bp
Gene Synonym
PEPC, PGII, FLJ99563, PGC
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human progastricsin (pepsinogen C) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.
References
  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.
  • TOP